Notes
Notes - notes.io |
We aimed to describe the characteristics and outcome in children with severe
pneumonia in a Chinese PICU.
A retrospective observational study from 2017 to 2019.
A 36-bed university tertiary PICU at Shanghai Children's Hospital.
Patients admitted to a tertiary PICU 29 days to 18 years old screened for laboratory-confirmed severe
pneumonia.
None.
Descriptive analysis of baseline characteristics for patients included hospital mortality, organ dysfunctions, use of mechanical ventilation, continuous renal replacement therapy, and/or extracorporeal membrane oxygenation. A total of 817 children with severe pneumonia were admitted to PICU, and 203 of 817 cases (24.8%) with severe
pneumonia were included in this study. The median age was 41 months (interquartile range, 20-67 mo), of which 77.3% (157/203) were younger than 6 years old. Among 163 patients with the test for macrolide resistance, 90.2% cases (147/163) were macrolide-resistant
. Severe
pneumonia-associated organ dysfunction includxtrapulmonary organ dysfunction and macrolide resistances. Extrapulmonary organ dysfunction and coinfection are associated with worse outcomes. The overall mortality is relatively low after treated with appreciate antibiotics, respiratory support, and extracorporeal life support.
Children with severe M. pneumoniae pneumonia mainly occur under the age of 6 years, showing a high proportion of extrapulmonary organ dysfunction and macrolide resistances. Extrapulmonary organ dysfunction and coinfection are associated with worse outcomes. The overall mortality is relatively low after treated with appreciate antibiotics, respiratory support, and extracorporeal life support.
Being a caregiver for a patient in the ICU can place emotional burden on families and engaging families in caregiving can reduce psychological distress. Our goal was to observe support methods used by families in the ICU and identify differences between race/ethnicity.
A secondary analysis of a multicenter before-and-after clinical trial.
Three hospitals in Chicago, Providence, and Florence, Italy.
Family members of patients admitted to the ICU.
In the primary study, an intervention was designed to engage families in seven domains that were based on the five physical senses (taste, touch, sight, smell, and sound), personal care, and spiritual care of the patient. During the control phase, nursing staff observed and recorded if they witnessed families participating in support methods unprompted.
We compared the use of support methods among families from different races, categorized by race as either White, Black, or other using generalized estimating equation population-averaged logistic regressionthe ICU.
Our understanding of the immunopathogenesis of coronavirus disease 2019 is evolving; however, a "cytokine storm" has been implicated. Ongoing clinical trials are evaluating the value of anticytokine therapies to treat patients with coronavirus disease 2019. This review summarizes the existing literature evaluating the efficacy and safety of anticytokine therapy to tackle the dysregulated immune response to infectious pathogens, discusses potential reasons for failure, applicability to coronavirus disease 2019, and future direction.
Medline, PubMed, ClinicalTrials.gov, and media reports.
The studies were included by author consensus.
Data were selected for inclusion after reviewing each study by author consensus.
"Cytokine storm" is a nonspecific term, encompassing systemic inflammatory response to infectious pathogens, autoimmune conditions, cancers, trauma, and various chemotherapies. Like bacterial sepsis, viral pathogens may fuel immunopathogenesis by inducing a dysregulated autoamplifying cytokirus disease 2019, clinicians should uphold caution when incorporating it into treatment protocols, while maintaining focus on established evidence-based practices and the mantra of "less is more."
Implement a connected network between two Tele-ICU programs to support staffing and rounding during the first wave of the coronavirus disease 2019 pandemic in the United States.
Proof of Concept model.
Northwell Health; a 23 Hospital, 40 ICU (500 ICU beds) healthcare organization serving the downstate NY area. During the initial coronavirus disease 2019 pandemic, Northwell Health rapidly expanded to greater than 1,000 ICU beds. The surge in patients required redeployment of noncritical care providers to the ICU bedside. The Tele-ICU program expanded from covering 176 beds pre pandemic to assisting with care for patients in approximately 450 beds via deployment of Wi-Fi-enabled mobile telehealth carts to the newly formed ICUs.
Critically ill coronavirus disease 2019 patients hospitalized at Northwell Health, NY, at any point from March 2020 to June 2020.
To offset the shortage of critical care physicians, Northwell Health established a collaboration with the Tele-ICU program of Providence, St. Joseph Health in the state of Washington, which enabled the critical care physicians of Providence, St. Joseph Health to participate in virtual rounding on critically ill coronavirus disease 2019 patients at Northwell Health.
We developed an innovative hybrid model that allowed for virtual rounding on an additional 40-60 patients per day by a remote critical care physician at Providence, St. Joseph Health. This was accomplished in approximately 3 weeks and provided remote care to complex patients.
Our findings demonstrate the proof of concept of establishing a network of connected Tele-ICU programs as a rapidly scalable and sustainable paradigm for the provision of support from critical care physicians for noncritical care teams at the bedside.
Our findings demonstrate the proof of concept of establishing a network of connected Tele-ICU programs as a rapidly scalable and sustainable paradigm for the provision of support from critical care physicians for noncritical care teams at the bedside.
Severe acute respiratory syndrome coronavirus-2 affects adults disproportionately more than children. A small proportion of children with severe acute respiratory syndrome coronavirus-2 required admission to a PICU. We describe the nationwide U.K. PICU experience of severe acute respiratory syndrome coronavirus-2 infection during the first wave of the pandemic and compare this with the critical care course of the 2019 influenza cohort.
Prospective nationwide cohort study of characteristics of severe acute respiratory syndrome coronavirus-2-positive children. Data collection utilized routine Pediatric Intensive Care Audit Network and severe acute respiratory syndrome coronavirus-2-specific data.
All U.K. PICUs.
Children less than 18 years old, admitted to U.K. PICUs between March 14, 2020, and June 13, 2020, and a positive severe acute respiratory syndrome coronavirus-2 polymerase chain reaction. Children admitted to U.K. PICUs in 2019 with influenza provided comparison.
None.
We identified 76 PICU 18%), higher weight
score (0.29 [-0.80 to 1.62] vs -0.41 [-1.37 to 0.63]), and higher deprivation index (3.3 [-1 to 6.3] vs 1.2 [-1.8 to 4.4]). Comorbidities, frequency of organ supports, and length of stay were similar.
This nationwide study confirms that PICU admissions with severe acute respiratory syndrome coronavirus-2 infections were infrequent. We have reported similarities and differences in sociodemographic characteristics, organ support interventions, and outcomes of children affected by severe acute respiratory syndrome coronavirus-2 compared with influenza.
This nationwide study confirms that PICU admissions with severe acute respiratory syndrome coronavirus-2 infections were infrequent. We have reported similarities and differences in sociodemographic characteristics, organ support interventions, and outcomes of children affected by severe acute respiratory syndrome coronavirus-2 compared with influenza.
Given finite ICU bed capacity, knowledge of ICU bed utilization during the coronavirus disease 2019 pandemic is critical to ensure future strategies for resource allocation and utilization. We sought to examine ICU census trends in relation to ICU bed capacity during the rapid increase in severe coronavirus disease 2019 cases early during the pandemic.
Observational cohort study.
Thirteen geographically dispersed academic medical centers in the United States.
We obtained daily ICU censuses from March 26 to June 30, 2020, as well as prepandemic ICU bed capacities. The primary outcome was daily census of ICU patients stratified by coronavirus disease 2019 and mechanical ventilation status in relation to ICU capacity.
None.
Prepandemic overall ICU capacity ranged from 62 to 225 beds (median 109). During the study period, the median daily coronavirus disease 2019 ICU census per hospital ranged from 1 to 84 patients, and the daily ICU census exceeded overall ICU capacity for at least 1 day at five insto ICU censuses greater than ICU bed capacity at fives of 13 institutions evaluated. These findings demonstrate the short-term adaptability of U.S. healthcare institutions in redirecting limited resources to accommodate a public health emergency.
The intestinal microbiome can modulate immune function through production of microbial-derived short-chain fatty acids. We explored whether intestinal dysbiosis in children with sepsis leads to changes in microbial-derived short-chain fatty acids in plasma and stool that are associated with immunometabolic dysfunction in peripheral blood mononuclear cells.
Prospective observational pilot study.
Single academic PICU.
Forty-three children with sepsis/septic shock and 44 healthy controls.
Stool and plasma samples were serially collected for sepsis patients; stool was collected once for controls. The intestinal microbiome was assessed using 16S ribosomal RNA sequencing and alpha- and beta-diversity were determined. We measured short-chain fatty acids using liquid chromatography, peripheral blood mononuclear cell mitochondrial respiration using high-resolution respirometry, and immune function using ex vivo lipopolysaccharide-stimulated whole blood tumor necrosis factor-α. Sepsis patients exhibited reducession of sepsis.
Intestinal dysbiosis was associated with altered short-chain fatty acid metabolites in children with sepsis, but these findings were not linked directly to mitochondrial or immunologic changes. More detailed mechanistic studies are needed to test the role of microbial-derived short-chain fatty acids in the progression of sepsis.
To investigate the change in rate of invasive procedures (endotracheal intubation, central venous catheters, arterial catheters, and peripheral inserted central venous catheters) performed in PICUs per admission over time. Secondarily, to investigate the change in type of respiratory support over time.
Retrospective study of prospectively collected data using the Virtual Pediatric Systems (VPS; LLC, Los Angeles, CA) database.
North American PICUs.
Patients admitted from January 2009 to December 2017.
None.
There were 902,624 admissions from 161 PICUs included in the analysis. Since 2009, there has been a decrease in rate of endotracheal intubations, central venous catheters placed, and arterial catheters placed and an increase in the rate of peripheral inserted central venous catheter insertion per admission over time after controlling for severity of illness and unit level effects. As compared to 2009, the incident rate ratio for 2017 for endotracheal intubation was 0.90 (95% CI, 0.83-0.98;
= cheal intubations, central catheter, and arterial catheter insertions per admission has decreased. The use of invasive mechanical ventilation has decreased with an increase in noninvasive respiratory support. These data support efforts to improve exposure to invasive procedures in training and structured systems to evaluate continued competency.
Families in the neurologic ICU urgently request goals-of-care decision support and shared decision-making tools. We recently developed a goals-of-care decision aid for surrogates of critically ill traumatic brain injury patients using a systematic development process adherent to the International Patient Decision Aid Standards. To widen its applicability, we adapted this decision aid to critically ill patients with intracerebral hemorrhage and large hemispheric acute ischemic stroke.
Prospective observational study.
Two academic neurologic ICUs.
Twenty family members of patients in the neurologic ICU were recruited from July 2018 to October 2018.
None.
We reviewed the existing critically ill traumatic brain injury patients decision aid for content and changed 1) the essential background information, 2) disease-specific terminology to "hemorrhagic stroke" and "ischemic stroke", and 3) disease-specific prognosis tailored to individual patients. We conducted acceptability and usability testing using le range, 61-93; with > 68 indicating good usability]); 89% of participants graded the decision aid content as good or excellent, and greater than or equal to 90% rated it favorably for information amount, balance, and comprehensibility.
We successfully adapted goals-of-care decision aids for use in surrogates of critically ill patients with intracerebral hemorrhage and hemispheric acute ischemic stroke and found excellent usability and acceptability. A feasibility trial using these decision aids is currently ongoing to further validate their acceptability and test their feasibility for use in busy neurologic ICUs.
We successfully adapted goals-of-care decision aids for use in surrogates of critically ill patients with intracerebral hemorrhage and hemispheric acute ischemic stroke and found excellent usability and acceptability. A feasibility trial using these decision aids is currently ongoing to further validate their acceptability and test their feasibility for use in busy neurologic ICUs.
Determine if thromboelastography parameters and platelet count on the day of ICU admission are associated with the development of venous thromboembolism in patients with coronavirus disease 2019.
Prospective, observational cohort study.
Tertiary-care, academic medical center in Nashville, TN.
Patients with coronavirus disease 2019 pneumonia and acute respiratory failure admitted to the adult ICU without venous thromboembolism at the time of ICU admission.
None.
The primary outcome was development of venous thromboembolism during the index hospitalization. Venous thromboembolism was defined by clinical imaging or autopsy, demonstrating deep vein thrombosis or pulmonary embolism. Forty consecutive critically ill adults with laboratory-confirmed coronavirus disease 2019 were enrolled; 37 (92.5%) were hypercoagulable by at least one thromboelastography parameter at the time of ICU admission and 12 (30%) met the primary outcome of venous thromboembolism during the index hospitalization. Patients who dea do not support the use of thromboelastography to risk stratify critically ill adults with coronavirus disease 2019 for the development of venous thromboembolism or to guide decisions about anticoagulation. Lower platelet count on ICU admission, which may reflect platelet aggregation, was associated with venous thromboembolism.
Our data do not support the use of thromboelastography to risk stratify critically ill adults with coronavirus disease 2019 for the development of venous thromboembolism or to guide decisions about anticoagulation. Lower platelet count on ICU admission, which may reflect platelet aggregation, was associated with venous thromboembolism.
To investigate implementation of evidence-based and supportive cares in ICUs, such as the ABCDEF, nutrition therapy, and ICU diary, for patients with coronavirus disease 2019 infection in ICUs and their association with ICU clinical practice and setting.
A worldwide, 2-day point prevalence study.
The study was carried out on June 3, 2020, and July 1, 2020. A total of 212 ICUs in 38 countries participated. Clinicians in each participating ICU completed web-based online surveys.
The ICU patients with coronavirus disease 2019.
None.
The implementation rate for the elements of the ABCDEF bundle, other supportive ICU care measures, and implementation-associated structures were investigated. Data were collected for 262 patients, of whom 47.3% underwent mechanical ventilation and 4.6% were treated with extracorporeal membrane oxygenation. Each element was implemented for the following percentages of patients elements A (regular pain assessment), 45%; B (both spontaneous awakening and breathing trials), 2low implementation of the ABCDEF bundle. Specific protocols and the number of ICU beds reserved for patients with coronavirus disease 2019 infection might be key factors for delivering appropriate supportive care.
Various ethical challenges are prevalent in ICUs. In order to handle these problems, a highly structured internal ethical case discussion within the multiprofessional team was implemented in 2011 in a Swiss ICU and has been regularly practiced almost weekly until present. To explore the results of all ethical case discussions taking place in a general ICU and to discuss the outcomes of the patients. To identify the conditions facilitating the implementation of regular ethical case discussions.
Retrospective case series analysis.
Mixed academic ICU.
All patients who had an ethical case discussion between January 2011 and December 2019 following the approach called Modular, Ethical, Treatment decisions, Allocation of resources at the micro-level, and Process.
Weekly ethical case discussions held regularly on a fixed date were found to be practical for the observed ICU. A total of 314 ethical case discussions were realized in 281 patients. Median patient age was 70 years (interquartile range, 62-77 yr)sions can be successfully implemented, enabling careful review of the patient's will and balancing it with the prognosis of the disease. This facilitates a necessary change of the therapeutic goal whenever appropriate.
Bacterial infections caused by antibiotic-resistant pathogens are a major problem for patients requiring critical care. An approach to combat resistance is the use of bacterial viruses known as "phage therapy." This review provides a brief "clinicians guide" to phage biology and discusses recent applications in the context of common infections encountered in ICUs.
Research articles were sourced from PubMed using search term combinations of "bacteriophages" or "phage therapy" with either "lung," "pneumonia," "bloodstream," "abdominal," "urinary tract," or "burn wound."
Preclinical trials using animal models, case studies detailing compassionate use of phage therapy in humans, and randomized controlled trials were included.
We systematically extracted 1) the infection setting, 2) the causative bacterial pathogen and its antibiotic resistance profile, 3) the nature of the phage therapeutic and how it was administered, 4) outcomes of the therapy, and 5) adverse events.
Phage therapy for the treatment of experimental infections in animal models and in cases of compassionate use in humans has been associated with largely positive outcomes. These findings, however, have failed to translate into positive patient outcomes in the limited number of randomized controlled trails that have been performed to date.
Widespread clinical implementation of phage therapy depends on success in randomized controlled trials. Additional translational and reverse translational studies aimed at overcoming phage resistance, exploiting phage-antibiotic synergies, and optimizing phage administration will likely improve the design and outcome of future trials.
Widespread clinical implementation of phage therapy depends on success in randomized controlled trials. Additional translational and reverse translational studies aimed at overcoming phage resistance, exploiting phage-antibiotic synergies, and optimizing phage administration will likely improve the design and outcome of future trials.As a consequence of the coronavirus disease 2019 (COVID-19) emergency, Italian physicians working in the field of aesthetic medicine and surgery considered appropriate to stop their activity in order to preserve patients' safety. This drastic measure obviously had an important impact on the medical aesthetic market causing growing concerns. To catch the current attitudes of the Italian consumers toward the aesthetic medicine and surgery, a medical advisory board devised an online survey; 216 clinicians finally participated in this survey and sent the online link through e-mail. A total of 8080/8640 (93.5%) questionnaires were returned, while 70 were removed. Approximately 49.0% (n = 3944) did not feel influenced in their desire for aesthetic treatments in spite of the pandemic emergency. Being influenced was not correlated with the uneven situation experienced on the Italian territory (r = -0.30, P = 0.196); 45.4% (n = 3636) declared to be ready for rescheduling their visit, and 60.5% (n = 4844) declared that they want to allocate the same amount of resources as before. The most missed aesthetic treatment was the face (71.1% [n = 5696]). Approximately 47.0% (n = 3759) and 46.0% (n = 3679) will come back to their physician without any request or with the need for an explanation about the security protocols, respectively. Approximately 40% (n = 3314) declared that their physical appearance affects their mood fairly, 27.0% (n = 2168) strongly or very strongly, and 71.3% (n = 5708) declared physical and/or psychological decline. Looked at together, the results give us some optimistic predictions, and, therefore, the authors are confident that their patients will come back to their clinics without any particular issues. However, ensuring patient safety must be our paramount task.The signature events caused by host-guest interactions in the nanopore system can be used as a novel and characteristic signal in quantitative detection and analysis of various molecules. However, the effect of several electrochemical factors on the host-guest interactions in nanopore still remains unknown. Here, we systematically studied host-guest interactions, especially oscillation of DNA-azide adamantane@cucurbit[6] in α-Hemolysin nanopore under varying pH, concentration of electrolytes and counterions (Li+, Na+, K+). Our results indicate correlations between the change of pH and the duration of the oscillation signal. In addition, the asymmetric electrolyte concentration and the charge of the counterions affects the frequency of signature events in oscillation signals, and even the integrity of the protein nanopore. This study provides insight into the design of a future biosensing platform based on signature oscillation signals of the host-guest interaction within a nanopore.High tumor mutational burden (TMB) is associated with response to checkpoint blockade in several cancers. We identify pathogenic germline variants associated with increased TMB (GVITMB). GVITMB were found in 7 genes using a pan-cancer approach (APC, FANCL, SLC25A13, ERCC3, MSH6, PMS2, and TP53) and 38 gene sets (e.g., those involved in DNA repair and programmed cell death). GVITMB were also associated with mutational signatures related to the dysfunction of the gene carrying the variant, somatic mutations that further affect the gene or pathway with the variant, or transcriptomic changes concordant with the expected effect of the variant. In a validation cohort of 140 patients with cutaneous melanoma, we found that patients with GVITMB had prolonged progression-free survival (p = 0.0349, hazard ratio = 0.688) and responded favorably (p = 0.0341, odds = 1.842) when treated with immune checkpoint inhibitors. Our results suggest that germline variants can influence the molecular phenotypes of tumors and predict the response to immune checkpoint inhibitors.Right ventricular hypertrophy (RVH) occurs in high pressure afterload, e.g., tetralogy of Fallot/pulmonary stenosis (TOF/PS). Such RVH is associated with alterations in energy metabolism, neurohormonal and epigenetic dysregulation (e.g., microRNA), and fetal gene reprogramming in animal models. However, comprehensive expression profiling of competing endogenous RNA in human RVH has not been performed. Here, we unravel several previously unknown circular, long non-coding, and microRNAs, predicted to regulate expression of genes specific to human RVH in the non-failing heart (TOF/PS). These genes are significantly overrepresented in pathways related to regulation of glucose and lipid metabolism (SIK1, FABP4), cell surface interactions (THBS2, FN1), apoptosis (PIK3IP1, SIK1), extracellular matrix composition (CTGF, IGF1), and other biological events. This is the first unbiased RNA sequencing study of human compensated RVH encompassing coding and non-coding RNA expression and predicted sponging of miRNAs by non-coding RNAs. These findings advance our understanding of adaptive RVH and highlight future therapeutic targets.Mangrove-dominated estuaries host a diverse microbial assemblage that facilitates nutrient and carbon conversions and could play a vital role in maintaining ecosystem health. In this study, we used 16S rRNA gene analysis, metabolic inference, nutrient concentrations, and δ13C and δ15N isotopes to evaluate the impact of land use change on near-shore biogeochemical cycles and microbial community structures within mangrove-dominated estuaries. Samples in close proximity to active shrimp aquaculture were high in NH4 +, NO3 - NO2 -, and PO4 3-; lower in microbial community and metabolic diversity; and dominated by putative nitrifiers, denitrifies, and sulfur-oxidizing bacteria. Near intact mangrove forests we observed the presence of potential nitrogen fixers of the genus Calothrix and order Rhizobiales. We identified possible indicators of aquaculture effluents such as Pseudomonas balearica, Ponitmonas salivi brio , family Chromatiaceae, and genus Arcobacter. These results highlight the sensitivity of the estuarine-mangrove microbial community, and their ecosystem functions, to land use changes.
Climate factors play an important role in the transmission of viruses, such as influenza viruses, MERS-CoV, and SARS-CoV-1. This study aimed to determine the relationship between changes in temperature, humidity, rainfall, and SARS-CoV-2 contagion. Five ecologically and climatically distinct regions were considered-Karachi, Lahore, Islamabad, Peshawar, and Gilgit-Baltistan.
Data on daily COVID-19 cases and deaths were retrieved from government officials, while meteorological information was collected from Pakistan Meteorological Department.. Statistical analysis was performed using SPSS version 20 and the Spearman rank correlation test was used to analyze the correlation between the meteorological factors and COVID-19 cases and deaths.
Positive correlation of COVID-19 incidence was observed with all the temperature ranges (maximum, minimum and average) and negative correlation was seen with humidity, DTR and rainfall. COVID-19 deaths were positively associated with temperature and were negatively associthe spread of COVID-19. Hence, effective mitigation policies, enhancing testing capacities, and developing public attitudes toward adopting precautionary measures are important to overcome this overwhelming pandemic.This study presents a natural language processing (NLP) tool to extract quantitative smoking information (e.g., Pack-Year, Quit Year, Smoking Year, and Pack per Day) from clinical notes and standardized them into Pack-Year unit. We annotated a corpus of 200 clinical notes from patients who had low-dose CT imaging procedures for lung cancer screening and developed an NLP system using a two-layer rule-engine structure. We divided the 200 notes into a training set and a test set and developed the NLP system only using the training set. The experimental results on the test set showed that our NLP system achieved the best F1 scores of 0.963 and 0.946 for lenient and strict evaluation, respectively.Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.The causation of Kawasaki disease has been a medical mystery for over 54 years. However, the causations of Kawasaki disease, its variations, and COVID-19-associated Multisystem Inflammatory Syndrome have been recently explained to involve high replication rate viral infections. In a subset of patients, the extensive antigen-antibody immune complexes that are not quickly cleared by phagocytosis will create a type III hypersensitivity immune reaction. The subsequent release of proteases and other enzymes and the expression or exposure of new immunogenic antigens due to protease attacks on basement membranes of epithelial cells or endothelial cells in blood vessels will induce new autoantibodies and cause Kawasaki disease, its variations, and COVID-19-related Multisystem Inflammatory Syndrome. There is now increasing evidence that a viral infection of a large surface area of tissue, such as the respiratory tract, gastrointestinal tract or blood vessels, and a resultant type III hypersensitivity immune reaction is the most plausible explanation for the causations of Kawasaki disease, its variations, and COVID-19-related Multisystem Inflammatory Syndrome. Furthermore, an improved understanding of these causations also suggests several potential new treatments which can be more effective.Due to the stringent awareness toward the preservation and resuscitation of natural resources and the potential economic benefits, designing sustainable manufacturing enterprises has become a critical issue in recent years. This presents different challenges in coordinating the activities inside the manufacturing systems with the entire closed-loop supply chain. In this paper, a mixed-integer mathematical model for designing a hybrid-manufacturing-remanufacturing system in a closed-loop supply chain is presented. Noteworthy, the operational planning of a cellular hybrid manufacturing-remanufacturing system is coordinated with the tactical planning of a closed-loop supply chain. To improve the flexibility and reliability in the cellular hybrid manufacturing-remanufacturing system, alternative process routings and contingency process routings are considered. The mathematical model in this paper, to the best of our knowledge, is the first integrated model in the design of hybrid cellular manufacturing systems which considers main and contingency process routings as well as reliability of the manufacturing system.With the recent SARS-CoV-2 outbreak, the importance of rapid and direct detection of respiratory disease viruses has been well recognized. The detection of these viruses with novel technologies is vital in timely prevention and treatment strategies for epidemics and pandemics. Respiratory viruses can be detected from saliva, swab samples, nasal fluid, and blood, and collected samples can be analyzed by various techniques. Conventional methods for virus detection are based on techniques relying on cell culture, antigen-antibody interactions, and nucleic acids. However, these methods require trained personnel as well as expensive equipment. Microfluidic technologies, on the other hand, are one of the most accurate and specific methods to directly detect respiratory tract viruses. During viral infections, the production of detectable amounts of relevant antibodies takes a few days to weeks, hampering the aim of prevention. Alternatively, nucleic acid-based methods can directly detect the virus-specific RNA or DNA region, even before the immune response. There are numerous methods to detect respiratory viruses, but direct detection techniques have higher specificity and sensitivity than other techniques. This review aims to summarize the methods and technologies developed for microfluidic-based direct detection of viruses that cause respiratory infection using different detection techniques. Microfluidics enables the use of minimal sample volumes and thereby leading to a time, cost, and labor effective operation. Microfluidic-based detection technologies provide affordable, portable, rapid, and sensitive analysis of intact virus or virus genetic material, which is very important in pandemic and epidemic events to control outbreaks with an effective diagnosis.
To evaluate the efficacy of the drain fluid cryo-explant (DFCE) technique for the management of uncomplicated superior bullous rhegmatogenous retinal detachment (RRD) in young adults.
A retrospective study that included eyes with uncomplicated superior bullous RRD in patients ⩽40 years old. DFCE technique consists of sequential drainage of subretinal fluid, intravitreal fluid injection, cryotherapy, and placement of a scleral explant(s). The primary outcome measure was anatomical reposition of the retina after a single surgery. Secondary outcome measures included improvement in best corrected visual acuity (BCVA) and any reported complication related to the procedure.
The study included 51 eyes which met the study eligibility criteria. The mean duration of detachment was 19.7 ± 6.4 days. A single retinal break was found in 31 eyes (60.8%), and more than one break were found in 20 eyes (39.2%). The mean number of breaks per eye was 1.72 ± 1.04. The mean detached area per eye was 7.21 ± 3.19 clock hours, and the macula was detached in 22 eyes (43.1%). Flattening of the retina and closure of all retinal breaks was achieved in all eyes after a single surgery. Late recurrence of retinal detachment occurred in two eyes (3.9%) due to proliferative vitreoretinopathy (PVR). No complicated cataract or iatrogenic retinal breaks were detected in all eyes.
DFCE technique could be effectively used for treatment of uncomplicated superior bullous RRD in adults ⩽40 years. It is safe and provides good visualization during surgery with no iatrogenic retinal breaks or complicated cataract.
DFCE technique could be effectively used for treatment of uncomplicated superior bullous RRD in adults ⩽40 years. It is safe and provides good visualization during surgery with no iatrogenic retinal breaks or complicated cataract.Amid the ongoing COVID-19 pandemic, public health authorities and the general population are striving to achieve a balance between safety and normalcy. Ever changing conditions call for the development of theory and simulation tools to finely describe multiple strata of society while supporting the evaluation of "what-if" scenarios. Particularly important is to assess the effectiveness of potential testing approaches and vaccination strategies. Here, an agent-based modeling platform is proposed to simulate the spreading of COVID-19 in small towns and cities, with a single-individual resolution. The platform is validated on real data from New Rochelle, NY-one of the first outbreaks registered in the United States. Supported by expert knowledge and informed by reported data, the model incorporates detailed elements of the spreading within a statistically realistic population. Along with pertinent functionality such as testing, treatment, and vaccination options, the model accounts for the burden of other illnesses with symptoms similar to COVID-19. Unique to the model is the possibility to explore different testing approaches-in hospitals or drive-through facilities-and vaccination strategies that could prioritize vulnerable groups. Decision-making by public authorities could benefit from the model, for its fine-grain resolution, open-source nature, and wide range of features.Purpose GI-4000, a series of recombinant yeast expressing four different mutated RAS proteins, was evaluated in subjects with resected ras-mutated pancreas cancer. Methods Subjects (n = 176) received GI-4000 or placebo plus gemcitabine. Subjects' tumors were genotyped to identify which matched GI-4000 product to administer. Immune responses were measured by interferon-γ (IFNγ) ELISpot assay and by regulatory T cell (Treg) frequencies on treatment. Pretreatment plasma was retrospectively analyzed by matrix-assisted laser desorption/ionization-time-of-flight (MALDI-ToF) mass spectrometry for proteomic signatures predictive of GI-4000 responsiveness. Results GI-4000 was well tolerated, with comparable safety findings between treatment groups. The GI-4000 group showed a similar pattern of median recurrence-free and overall survival (OS) compared with placebo. For the prospectively defined and stratified R1 resection subgroup, there was a trend in 1 year OS (72% vs. 56%), an improvement in OS (523.5 vs. 443.5 days [hazard ratio (HR) = 1.06 [confidence interval (CI) 0.53-2.13], p = 0.872), and increased frequency of immune responders (40% vs. 8%; p = 0.062) for GI-4000 versus placebo and a 159-day improvement in OS for R1 GI-4000 immune responders versus placebo (p = 0.810). For R0 resection subjects, no increases in IFNγ responses in GI-4000-treated subjects were observed. A higher frequency of R0/R1 subjects with a reduction in Tregs (CD4+/CD45RA+/Foxp3low) was observed in GI-4000-treated subjects versus placebo (p = 0.033). A proteomic signature was identified that predicted response to GI-4000/gemcitabine regardless of resection status. Conclusion These results justify continued investigation of GI-4000 in studies stratified for likely responders or in combination with immune check-point inhibitors or other immunomodulators, which may provide optimal reactivation of antitumor immunity. ClinicalTrials.gov Number NCT00300950.
To establish the extent to which sound amplitudes delivered by a vibrating tuning fork change around its long axis and to evaluate whether such differences in amplitude might change the results of the Rinne test.
Experimental measurements.
Laboratory setting.
Setup I a vibrating tuning fork was handheld and manually rotated around its long axis next to a sound recording device (the simulated ear) in order to record sound amplitude data at a full range of angles relative to the device; files were split into segments in which sound amplitude changed A (from a maximum to a minimum) and B (from a minimum to a maximum). Setup II a vibrating tuning fork was machine-rotated, and the angle of rotation, along with the sound amplitude, was automatically recorded through a single full rotation.
The angles of 0° and 180° (which equate to the established best practice in Rinne testing) were associated with the highest sound amplitudes. All other angles decreased sound amplitude. The greatest decrease in amplitude was recorded at 51° and 130°. This difference ranged from 9.8 to 34.7 dB, depending on the initial amplitude.
The outcome of a Rinne test can be affected if attention is not paid to the precise angle at which the tuning fork is held relative to the ear. The potential of this effect will be greater when high background noise or patient hearing loss requires that the tuning fork be vigorously excited to obtain high sound amplitudes.
The outcome of a Rinne test can be affected if attention is not paid to the precise angle at which the tuning fork is held relative to the ear. The potential of this effect will be greater when high background noise or patient hearing loss requires that the tuning fork be vigorously excited to obtain high sound amplitudes.
The recent outbreak of the COVID-19 altered the traditional paradigm of clinical medical education. While individual clerkships have shared their curricular adaptations via social and academic networking media, there is currently no organizational standard in establishing a non-clinical, Emergency Medicine (EM) virtual rotation (VR). The primary objective of this study was to describe EM clerkship directors' (CDs) perspectives on their experience adapting an EM VR curriculum during the onset of the COVID-19 pandemic.
A 21-item survey with quantitative and qualitative questions was disseminated between June and August 2020 to EM CDs via the Clerkship Director of Emergency Medicine (CDEM) Listserv to describe their experience and perspectives in adapting a VR during the spring of 2020.
We analyzed 59 out of 77 EM clerkship survey responses. Among respondents, 52% adapted a VR while 47.5% did not. Of those who adapted a VR, 71% of CDs had 2 weeks or less to develop the new curriculum, with 84% reporting uslearning with limited time, this was not equivalent to the formal development of pre-planned VR experiences. Future faculty development and curriculum innovation are required to fully transition an in-person immersive experience to a non-inferior virtual experience.The COVID-19 pandemic has dramatically affected medical education. Emergency medicine (EM) requires excellence in multiple core competencies, including leadership, teamwork and communication skills, as well as procedural experience. To meet these objectives, we developed a hybrid simulation model that accommodated a reduced number of learners in our simulation center to allow for physical distancing, seamlessly integrated with an on-line integrated experience for remote learners. All learners participated or watched one adult and one pediatric simulation case. Fourteen residents participated in live simulation, while six residents and six medical students comprised the remote group. At the end of each case, the live-feed was ended, and separate debriefings were conducted by different EM faculty, in-person and on-line (via Zoom). An electronic survey was then sent to participants to rate the effectiveness of the intervention; 23 survey responses were collected 52.2% (12) from the live session and 47.2% (11) from the virtual session. Survey results demonstrated that the on-line simulation observation and debriefing had the same, if not better, satisfaction than in-person simulation sessions and debriefings. Due to its success, this new method of hybrid simulation will be our plan for the foreseeable future, at least until COVID-19 abates.
The COVID-19 pandemic posed significant challenges to traditional simulation education. Because simulation is considered best practice for competency-based education, emergency medicine (EM) residencies adapted and innovated to accommodate to the new pandemic normal. Our objectives were to identify the impact of the pandemic on EM residency simulation training, to identify unique simulation adaptations and innovations implemented during the pandemic, and to analyze successes and failures through existing educational frameworks to offer guidance on the use of simulation in the COVID-19 era.
The Society for Academic Emergency Medicine (SAEM)'s Simulation Academy formed the SimCOVID task force to examine the impact of COVID-19 on simulation didactics. A mixed-methods approach was employed. A literature search was conducted on the subject and used to develop an exploratory survey that was distributed on the Simulation Academy Listserv. The results were subjected to thematic analysis and examined through existnd organizational capacity to support simulation-based efforts for the evolving clinical and educational landscape.
Offset analgesia (OA), a large reduction in pain after a brief increase in intensity of an otherwise stable painful stimulus, has been established by a large body of research. But the opposite effect, onset hyperalgesia (OH), a disproportional hyperalgesic response after a briefly decreased intensity of a painful stimulus, has only been investigated in one previous study.
The aim of this study was to induce OA and OH in healthy participants and explore the effects of different stimulus ranges (increase/decrease of temperature) on OA and OH.
A total of 62 participants were tested in 2 identical experiments. Offset analgesia and OH conditions included 2 different temperature deviations (±1°C/±2°C) from initial temperature and were compared with a constant temperature (control).
Offset analgesia was successfully elicited in OA
in experiment 1, and in OA
and OA
in experiment 2. Results indicate a continuous stimulus-response relationship between the stimulus range and the resulting hypoalgesic respoe to following changes in temperature.The COVID-19 pandemic has affected daily lives of people around the world. People have already started to live wearing masks, keeping a safe distance from others and maintaining a high level of hygiene. This paper deals with an in-depth analysis of riskness associated with COVID-19 infections in Kolkata Municipal Corporation (KMC) at the sub-city (ward) level. Attempts have been made to identify the areas with high or low risk of infections using GIS-based geostatistical approach. Cosine Similarity Index has been used to rank different wards of KMC according to the degree of riskness. Four indices were computed to address intervention objectives and to determine 'Optimized Prevention Rank' of wards for future policy decisions. The highest risk areas were located in the eastern and western part of the city, to a great extent overlapped with wards containing larger share of population living in slums and/or below poverty level. While, highly infected areas lie in central Kolkata and in several wards at the eastern and northeastern periphery of the KMC. The 'Optimized Prevention Rank' have indicated that the lack of social awareness along with lack of social distancing and high susceptibility have contributed to the increasing number of containments of COVID-19 cases. The rankings of the wards would no doubt provide the policy makers a basis to control further spread of the disease or delay a second wave. Since effective antiviral drugs are far away, the application of our approach would save the lives of many people, especially the poor and underprivileged.With the emergence of new pathogens like coronavirus disease 2019 and the prevalence of cancer as one of the leading causes of mortality globally, the effort to develop appropriate materials to address these challenges is a critical research area. Researchers around the world are investigating new types of materials and biological systems to fight against various diseases that affect humans and animals. Carbon nanostructures with their properties of straightforward functionalization, capability for drug loading, biocompatibility, and antiviral properties have become a major focus of biomedical researchers. However, reducing toxicity, enhancing biocompatibility, improving dispersibility, and enhancing water solubility have been challenging for carbon-based biomedical systems. The goal of this article is to provide a review on the latest progress involving the use of carbon nanostructures, namely fullerenes, graphene, and carbon nanotubes, for drug delivery, cancer therapy, and antiviral applications.
To describe a case of asymmetric optic disc edema presenting as the initial ocular feature of POEMS (Polyneuropathy, Organomegaly, Endocrinopathy, Monoclonal gammopathy, Skin changes) syndrome.
A 29-year-old female patient presented with 3 weeks history of blurred vision, proptosis, and peripheral neuropathy as well as hypothyroidism. Fundoscopy revealed optic disc edema associated with visual loss in the left eye. Following a computed tomography (CT) scan and a positron emission tomography/CT (PET/CT) scan which respectively revealed hepatomegaly and multiple osteosclerotic lesions, as well as laboratory findings of monoclonal gammopathy and elevated vascular endothelial growth factor (VEGF) levels, she was diagnosed with POEMS syndrome. After treatment with an autologous stem cell transplant, the optic disc edema and blurred vision resolved.
The most reported ocular manifestation of POEMS syndrome, a rare and complex multisystem disorder, is bilateral optic disc edema that typically occurs in older males. Therefore, this report presents an uncommon case of asymmetric optic disc edema in a younger, female patient.
The most reported ocular manifestation of POEMS syndrome, a rare and complex multisystem disorder, is bilateral optic disc edema that typically occurs in older males. Therefore, this report presents an uncommon case of asymmetric optic disc edema in a younger, female patient.
To describe a rare case of racemose hemangioma which developed spontaneous macular macroaneurysm (MA) rupture and vitreaous hemorrhage.
A 29-year-old healthy asian female visited our hospital and a racemose hemangioma was found in the left eye. At presentation, the best corrected visual acuity (BCVA) was 30/20 in her left eye. At 9 years after the first visit, MA-like lesion was noted in the macular area. After that, vitreous and subretinal hemorrhage appeared in the left eye. The patient underwent simultaneous vitrectomy and cataract surgery, but vitreous re-hemorrhage occurred two days after the operation. To avoid re-hemorrhage, silicone oil (SO) tamponade was added in the second vitrectomy. Two years after the second operation, SO was removed and postoperative BCVA in the left eye was 20/200 without re-bleeding in the vitreous.
Although retinal hemorrhages have been reported in the patients with a racemose hemangioma, in our case the macular MA rupture occurred at 9 years after the first visit. Congenital retinal arteriovenous anastomosis can show a change in vascular shape in some cases, thus it is important to observe carefully.
Although retinal hemorrhages have been reported in the patients with a racemose hemangioma, in our case the macular MA rupture occurred at 9 years after the first visit. Congenital retinal arteriovenous anastomosis can show a change in vascular shape in some cases, thus it is important to observe carefully.
Read More:
|
Notes.io is a web-based application for taking notes. You can take your notes and share with others people. If you like taking long notes, notes.io is designed for you. To date, over 8,000,000,000 notes created and continuing...
With notes.io;
- * You can take a note from anywhere and any device with internet connection.
- * You can share the notes in social platforms (YouTube, Facebook, Twitter, instagram etc.).
- * You can quickly share your contents without website, blog and e-mail.
- * You don't need to create any Account to share a note. As you wish you can use quick, easy and best shortened notes with sms, websites, e-mail, or messaging services (WhatsApp, iMessage, Telegram, Signal).
- * Notes.io has fabulous infrastructure design for a short link and allows you to share the note as an easy and understandable link.
Fast: Notes.io is built for speed and performance. You can take a notes quickly and browse your archive.
Easy: Notes.io doesn’t require installation. Just write and share note!
Short: Notes.io’s url just 8 character. You’ll get shorten link of your note when you want to share. (Ex: notes.io/q )
Free: Notes.io works for 12 years and has been free since the day it was started.
You immediately create your first note and start sharing with the ones you wish. If you want to contact us, you can use the following communication channels;
Email: [email protected]
Twitter: http://twitter.com/notesio
Instagram: http://instagram.com/notes.io
Facebook: http://facebook.com/notesio
Regards;
Notes.io Team