Notes

Usefulness And Tolerability Associated with Mouth Metal Chelator, Deferasirox.
Bacterial panicle blight (BPB) caused by Burkholderia glumae is one of the most severe seed-borne bacterial diseases of rice in the world, which can decrease rice production by up to 75%. Nevertheless, there are few effective measures to manage this disease. In an attempt to develop an alternative management tool for BPB, we isolated and characterized phages from soil and water that are effective to lyse several strains of B. glumae. After tests of host ranges, the phages NBP1-1, NBP4-7 and NBP4-8 were selected for further comprehensive characterization, all of which could lyse B. glumae BGLa14-8 (phage sensitive) but not B. glumae 336gr-1 (phage insensitive). This result indicates that the phages killing B. glumae cells have specific host ranges at the strain level within the bacterial species. In the greenhouse condition of this study, foliar application of the phage NBP4-7 could reduce the severity of BPB caused by B. glumae BGLa14-8 up to 62%, but did not cause any significant effect on the infection by B. glumae 336gr-1. Electron microscopy and whole-genome sequencing were also performed to characterize the three selected phages. Transmission electron microscopy revealed that the selected phages belong to the family Myoviridae. Furthermore, whole genome sequence analysis indicated that the three phages belong to a same species and are closely related to the Burkholderia phage KL3, a member of the Myoviridae family.Powdery mildew, caused by fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is one of agronomically important and widespread wheat diseases causing severe yield losses. Deployment of broad-spectrum disease-resistance genes is the preferred strategy to prevent this pathogen. Chinese wheat landrace Honghuaxiaomai (HHXM) was resistant to all 23 tested Bgt isolates at the seedling stage. The F1, F2, and F23 progenies derived from the cross HHXM × Yangmai 158 were used in this study, and genetic analysis revealed that a single dominant gene, designated as PmHHXM, conferred resistance to Bgt isolate E09. Bulked segregant analysis and molecular mapping initially located PmHHXM to the distal region of chromosome 4AL. To fine map PmHHXM, two critical recombinants were identified from 592 F2 plants and delimited PmHHXM to a 0.18-cM Xkasp475200-Xhnu552 interval covering 1.77-Mb, in which a number of disease resistance-related gene clusters were annotated. Comparative mapping of this interval revealed a perturbed synteny among Triticeae species. This study reports the new powdery mildew resistance gene PmHHXM that seems different from three known QTL/genes identified on chromosome 4AL and has significant values for further genetic improvement. Analysis of the polymorphisms of 13 co-segregating markers between HHXM and 170 modern wheat cultivars indicates that Xhnu227 and Xsts478700 developed here are ideal for marker-assisted introgression of this resistance gene in wheat breeding.Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. check details Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.In late summer 2019, a severe outbreak of fruit rot was observed in commercial 'Pink Lady' apple orchards (>20 ha in total) in the region Emilia-Romagna (Northern Italy). The symptoms on the fruit appeared as small circular red to brown lesions. Disease incidences of over 50% of the fruits were observed. To isolate the causal agent, 15 affected apples were collected and small portions of fruit flesh were excised from the lesion margin and placed on potato dextrose agar (PDA). The plates were incubated at 20°C in the dark, and pure cultures were obtained by transferring hyphal tips on PDA. The cultures showed light to dark gray, cottony mycelium, with the underside of the culture being brownish and becoming black with age. Conidia (n=20) were cylindrical, aseptate, hyaline, rounded at both ends, and 12.5 to 20.0 × 5.0 to 7.5 μm. The morphological characteristics were consistent with descriptions of Colletotrichum species of the C. gloeosporioides species complex, including C. fructicola (Weir et al. 2012). Thelso the potential agent of Glomerella leaf spot (GLS) of apple (Velho et al. 2015; 2019). To the best of our knowledge this is the first report of C. fructicola on apples in Italy. It is important to stress that the C. gloeosporioides species complex is still being resolved and new species on apple continue to be identified, e.g. C. chrysophilum that is very closely related to C. fructicola (Khodadadi et al. 2020). Given the risks of this pathogen the presence of C. fructicola in European apple orchards should be assessed and management strategies developed.
Here's my website: https://www.selleckchem.com/products/sgi-110.html